banner_editeur_1
BD inédite
5 J aime ! 6

Aprés la vaccination, je suis trés ouvert

Aprés la vaccination, je suis trés ouvert

Commentaire de l'auteur

Les musiciens (surtout les guitaristes) comprendront. ;)

Rebonds :

Cette BD vous a inspiré ? Rebondissez dessus en créant une BD liée : Rebondir...

Transcript

Case 1:Bird 1: Avant que je sois vacciné avec Pfizer mon ADN était catcatctcgccctttcaacctacaa ctattcaatttagc | Case 2: Bird 1: Depuis il est devenu DGBGBDDADGADDADGCD DGBGBDDGBGBDDGBGBD | Case 3: Bird 1: Maintenant je joue toujours de la guitare en accords ouverts

5 réponses à “Aprés la vaccination, je suis trés ouvert”

  1. jmf08 dit :

    Un ♥ de bon retour après 1 mois ! 😉

  2. jeppy dit :

    Bof ! A chaque fois que je publie ici, il faut toujours qu’il y ait un modérateur qui vienne faire son intéressant en indiquant une erreur …. sans évidemment dire laquelle… ce serait trop facile.

  3. moderateur5 dit :

    Jeppy, la modification à faire est clairement indiquée par Me Corbac « petite bulle case 3 », ce qui signifie qu’il faut mettre une petite bulle case 3, la petite bulle étant celle ne comportant que 2 lignes au lieu de 4. Est-ce plus clair ? 😛

  4. Trevor dit :

    Modérateur5, tu veux dire que Jeppy a une case trop vide ??? 😀

  5. jeppy dit :

    @Trevor : J’ai encore beaucoup de neurones vides dans mon cerveau, mais j’ai peut-être aussi un grain dans l’un d’entre-eux ! 🙂

Laisser un commentaire

Ce site utilise Akismet pour réduire les indésirables. En savoir plus sur comment les données de vos commentaires sont utilisées.